Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059E7
Clone ID IST15059E7
Vector VICTR80
Project tigm

Sequence tag IST15059E7HMR1
Sequence
AAGTTGCCNATATTTGATTGTGAACTGGGACAGGGACACAGGGGAAGTCAAGGCAATGTTAGGATTATTGATTAAGGTTA
CTATTTAATTCTTACGGAATACTTGAGTAGGCGTGGGTAGGATTACATTTCACTACTGATTTCCTTAAAGTGAAGATAGC
GTTCGTTTCAGAGAAAGCTGCAAATGCTCTATAATAAACTAAGATAGTTATGTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154271574..154271790 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]


Sequence tag IST15059E7HMF1
Sequence
CTTTAAGCTGGGTGTGGCANCATCTGGCACACTCTTATAAAGCTTGCACTAAAGCAGAAGGTTGAGGAGTTCAAGACCAT
CTTCAGATAATAGGGAGTTCAAAGCCNGCCTGGGCTANAANAACCTATCTTTAAATAATGGCTCACACCTTAAATCCCAG
GCAAAATGCATATAACAAAAAAGTCCAATTTTTAAATGTAANAAAAGTANNCTTTTTAAATGTAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154271346..154271576 215
NO GENE  


Sequence tag IST15059E7BBF1
Sequence
CTTTAAGCTGGGTGTGGCAGCATCTGGCACACTCTTATAAAGCTTGCACTAAAGCAGAAGGTTGAGGAGTTCAAGACCAT
CTTCAGATAATAGGGAGTTCAAAGCCAGCCTGGGCTAGAAGAACCTATCTTTAAATAATGGCTCACACCTTAAATCCCAG
GCAAAATGCATATAACAAAAAAGTCCAATTTTTAAATGTAAGAAAAGTAAGCTTTTTAAATGTAAGAAAAATAAGCTTTC
AACATAGTTGACACCTCCATTATTTAAAATTAAAAGAGCAGAAGAGCAGGGTGGTGGTGGCGTACGCCTTTAATCCCAGC
ACTTGGGAGGCAGANGCAGGCGGATTTCTGAGTTCCAGGACATCCAGGGCTACACAGAGAAACCCTGTCTCANACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154271180..154271576 393
NO GENE  

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es