Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10432E5
Clone ID IST10432E5
Vector VICTR76
Project tigm

Sequence tag IST10432E5HMF2
Sequence
CCCACCTCCATTAAGGAGGGTACCAGCTGCTCAAGAAACTGGAATTTCTGGCCCGGTGTGGCCCACAGCTTCTTGTCCCT
AATCTCCCTCTGATTATCTGTGCGTCTCTTGCTCTCCCTCCCTGTGAGTCATCTGCATTCATGGGGCCACACCCCCCCTC
TCTCCTTTTCTCTTTCCAGGAAGCACTGCCCTTCATTTGGA
Sequence Type genomic DNA
Unitrap ID UNI17233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96483374..96483573 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST10432E5BBF1
Sequence
CTTGTCTGTCCTCCAAGGACACTAGGCACATGTATGGTGCAGGTATGTATGCAAACATGTNANCNAAAATCTATACACAT
AAAATAAATATTAAAAAAATGAGACAAGTAAATCACTATATGGTTCAGCCGATAATTTATTGGGCACCCACGTCTAGAAG
CCAGATCATTGAAGAATTTGTGCAGGCAGAACTTGACTCTTCTTCATCCATTCAAAAGGATTACCGTAAAGCCAGACATG
TGGGAACATTCCTGCNNNCCANCATTTGAAGGATAGGATCAGGAATTCTGGGCCNNCCTGGGCTACATGANACCCTAGCT
CCAAATAAAACACAATAAAAAGGCCACTTTATCAACAGCACTCATCTAAAAGTAGCACCTGGTATNNNTCCTACTGGAAT
CCCTANATNAATAAATGTGTTTGTAAATCCTGAACTTNAAGTGGCTTCAGTAAGAACAGCTTGGAAAAATGTCTCTGTAC
AGACTTGATTTCTAATTGTGGTGAANCTTCATTCCTTAAACCATCTATTCAACATGAACTCACTCTCCAAACTTGCATCT
GCTNGNCTCCGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 95028447..95029019 535
 
EST/CDNA Est Name
  AI507268.1

 
Come back to gene AI507268.1


For any suggestions or comments, please send an email to unitrap@crg.es