Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14651A6
Clone ID IST14651A6
Vector VICTR74
Project tigm

Sequence tag IST14651A6HMR1
Sequence
CCGCCACAGTCACATAATGCTTGCGTTCTGACTGTACGACATCTTATATTTCAGCNNTGAGTCGGGTTTGCTTCCCCCAG
GACCCCCGAGTTCCTTCCTCTCTGCCTTCTTTAGAGGTAGGATGGAGGCTGCCTGTTACCCATGCTTTGAAGAGAGGCTG
AGCTACAGAGTGAATAAGCGCGTGGAGGAGGGAGTCTCTGAGTGCAGTTTGTGCTCTTCCCCAGGGTCCTTCTTCNTCGN
GACTCANTATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855438..97855691 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST14651A6HMF1
Sequence
GCGGGAGTGGCTGGTAATTCCTCCTTACTCACCCTGCACTATGAAGAGGATACAGAGAAAGCTTCTTATACTCCTGATAC
ATTTCAAAGTTTAACAATAACTTAATAAATGACCTGAAATATAGAAAGACATGAACTGTAACTGAAGCTTCCACTAAAAT
ACATGCTGTTCTTTCTATTAAGTACCCACCGTCCTTGCCTCTAGGACACGAGCAACTCCAGTGCTCCATGACAGATTACC
AAACACTGCTTACAAGCTCACAGAAGCAATGAACCAAGCCCAGANAAAGGACTTAAAGGGATCCCATAAGACAGTGTCCA
CTTCAATATTAAATCTCGAACTTGGTTTTATACCTGGTTTCTTTATCATATAATCACATCTGACGTTTATGGGATTTATA
AATTCGATAGGGGTGCANTATGGCCTCCAAGACTACTTCTGTAACAGAAATACANACAATACACTTAGTGTTTCCACTAT
CTTTACCATANNATACCACAGACATTTGTCTNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97854931..97855441 501
 
EST/CDNA Est Name
  CX733968.1


Sequence tag IST14651A6BBF1
Sequence
GCGGGAGTGGCTGGTAATTCCTCCTTACTCACCCTGCACTATGAAGAGGATACAGAGAAAGCTTCTTATACTCCTGATAC
ATTTCAAAGTTTAACAATAACTTAATAAATGACCTGAAATATAGAAAGACATGAACTGTAACTGAAGCTTCCACTAAAAT
ACATGCTGTTCTTTCTATTAAGTACCCACCGTCCTTGCCTCTAGGACACGAGCAACTCCAGTGCTCCATGACAGATTACC
AAACACTGCTTACAAGCTCACAGAAGCAATGAACCAAGCCCAGAGAAAGGACTTAAAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855139..97855441 303
 
EST/CDNA Est Name
  CX733968.1

 
Come back to gene CX733968.1


For any suggestions or comments, please send an email to unitrap@crg.es