Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P064F11
Clone ID P064F11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P064F11
Sequence
ACGGGGCCTGCGGACTCGGATAACAGATCGGAGTCAGCACCGGGACGGTGGAAATATCGGCCTGTGTNCTGGAGAAATAC
AG
Sequence Type mRNA
Unitrap ID UNI5427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70350747..70351284 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es