Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10110D12
Clone ID IST10110D12
Vector VICTR76
Project tigm

Sequence tag IST10110D12HMF1
Sequence
ATAGCCTCTGCCGCTTTCTCCTTTGCCAGTTTCCATGAAATCTTACGGATTATCTCTCACTACTGCTGCCCTAGGTAATG
AGGAAAAGAAAATGGCGGCGGAAAAGGCTAGAGGCGAGGGCGAAGAGGGGTCCTTCAGTCTCACAGTCGAAGAGAAGAAG
GCGCTTTGTGGATTAGATAGGTACGCACTGCTAATACTTACAGGTTGTCTTTCTCTCTCCGGGTTCAAAAGACTCTCCAG
GAGGCCTGACTGCATCTTGCTTGCGGTGACGACTCGCTTTCNCCTANCACTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI31549

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 581733..582029 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068457 (Uty) NM_009484 ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome Gene [Source:MGI Symbol;Acc:MGI:894810]


Sequence tag IST10110D12BBR1
Sequence
GCTATCTGGTCACATTACCACGCAGATGGTGAACGCAAGAAGAACTCATTGTTGCAGAACCTAAGCGAAGTTCTTAGAAT
ATCAAACTTCGCTAGCATCCGCATAAAGTTGTTATAATACCGTCAGTGTGAACCGCACGTAACGTCCATAACCTCTCCCT
AAAGCCAGGCTTTCCAATGGAAGCAACCGTTTTATCCCACGTGACTTTTGTTGACTTGCGTCATCACCAGTGCAGCTAAA
CTTGCTACTTCGCTAGCTCGTGATGTCAGCCTAAGAGCTCTACCTACCGACCACAGTGAAATTAGTTTTAGGTATGCTTT
GTAACTCTTTCTTATTCCACACTAGATATCCAGACCCTTTCATTTAATTGCTATACTGATCTCACAAGGAACAAAGAGCA
CTAAGAAAAAATACATCAAACATCGGTTTTTAGGGCACATGAAAGCCAATTAGAGACCAAATAGTTAAAAAAAAAAATTT
TCCTCTTGCCTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 582025..582515 491
 
EST/CDNA Est Name
  AK043154.1 - NM_009484.2


Sequence tag IST10110D12BBF1
Sequence
ATAGCCTCTGCCGCTTTCTCCTTTGCCAGTTTCCATGAAATCTTACGGATTATCTCTCACTACTGCTGCCCTAGGTAATG
AGGAAAAGAAAATGGCGGCGGAAAAGGCTAGAGGCGAGGGCGAAGAGGGGTCCTTCAGTCTCACAGTCGAAGAGAAGAAG
GCGCTTTGTGGATTAGATAGGTACGCACTGCTAATACTTACAGGTTGTCTTTCTCTCTCCGGGTTCAAAAGACTCTCCAG
GAGGCCTGACTGCATCTTGCTTGCGGTGACGACTCGCTTTCGCCTAGCACTGTTAACAATGTTTTGGGAGATTTTTTACT
GATGTCTTTCTGTGATCATTAACAAGAGCCATGTATTTCTTCCACAGCAGCTTCTTCGGGTTCTTGACCCGATGCAAAGA
TGGCGCCAAGATGAAGACGCTGTTGAACAAGGTCAGCAACTGTTTAAACATAATTACTTATATTTTTCTCCTAAGCTTTT
CACTGTTCCAAGCCTGGAGCCTCTCCCTACTCTGAAAGTGCTCATTATAGCTTTTAGGGA
Sequence Type genomic DNA
Unitrap ID UNI23633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 581490..582029 540
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068457 (Uty) NM_009484 ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome Gene [Source:MGI Symbol;Acc:MGI:894810]

 
Come back to gene ENSMUSG00000068457


For any suggestions or comments, please send an email to unitrap@crg.es