Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M094C02
Clone ID M094C02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag M094C02
Sequence
TCCAAGATGGCGACTCCCATGCATCGGCTCATAGCTCGAAGGAAAGC
Sequence Type mRNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138197..53138243 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es