Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P064E04
Clone ID P064E04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P064E04
Sequence
TACTGGGACATGCGCGTTTCGGCCGAAGGGGGCTAAAATTTCCCAACTCCAGGAATTGGTGGCGGAGAGGGGGCAAGTCA
CCAGGGCTCTTCCCGGCGCCCCAATGCGCGCACCATGTCGAGGCGCAAGCAGGCGAAGCCCCAGCACATCAACTGGGAGG
AGGGCCAGGGCGAGCAGCCTCAGCAGCTACCGAGCCCCGACCTCGCCGAGGCGCTGGCGGCGGAGGAACCCG
Sequence Type mRNA
Unitrap ID UNI1046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168592412..168592643 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es