Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12680G12
Clone ID IST12680G12
Vector VICTR76
Project tigm

Sequence tag IST12680G12BBF1
Sequence
CATGAAAGGAATTGTGGTAGTAGGAGGTTGACTGCTCACATTGTATCTACAGTCCAAATATGAACAGGGAGAAGTACCAG
GCTGTAGAGCCACAAGGCCTGCTCCCAGTAACCCACTTCCTACCCCAAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI23038

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45585122..45585256 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST12680G12HMF2
Sequence
ACAAATGTGCAGGAACTGGCTCTCCACGTTTACTGTGTGGAATCTGGGGTCAAAGTCAGGTCACCAGGCTTGATGGCAGG
CTCCTCTATCTGCTGAGTTTTGGTTTTGGAGACTGGTTCTCTATGTACTCCAAGCTTGCCAGTCTCATANACTGGTCTGC
TATGGTCTTCTCCGTGTTTCATGCTACTAGGTTAANGGAANAGTTTGNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94913878..94914087 202
NO GENE  

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es