Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12111H5
Clone ID IST12111H5
Vector VICTR76
Project tigm

Sequence tag IST12111H5HMF1
Sequence
ATTTTGTACTGATAGTTCCTGGAGTACCATTGAACAGAAATCCAAAAACAGAAACAGTAGTTAAAAAATAAATAGGAAGT
CTGCCCTTGAAGCTACTTGTCATTCAACAGGTTTTCTTCTTAATTAAAAACGTTTTTATTANCTGGGCGTGGTGGCACAC
ACTTTTAGTCCCCGCACTTGGGAGGCAGAGGCAGGAGGATCTCTGAGTTTGAGGCCNGCCTGGTCTACAGAGTGAGTTCC
AGGACAGCCNGGGCTACNCANAAAAANNCTGTCTCGAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI20533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27423473..27423758 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]


Sequence tag IST12111H5BBF1
Sequence
ATTTTNNNCTGATAGTTCCTGGAGTACCATTGAACANAAATCCAAAAACAAAAACAGTANTTAAAAAATAAATAGGAAGT
CTGCCCTTGAAGCTACTTGTCATTCAACAGGTTTTCTTCTTAATTAAAAACGTTTTTATTANCTGGGCGTGGTGGCACAC
ACTTTTANTCCCCGCACTTGGGAGGCAGAGGCAGGAGGATCTCTGANTTTGAGGCCNGCCTGGTCTACANANTGAGTTCC
AGGACAGCCAGGGCTACNCNNAAAAACCCTGTCTCGAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040818


For any suggestions or comments, please send an email to unitrap@crg.es