Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P063D01
Clone ID P063D01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P063D01
Sequence
GCGCGCCCACCCGTTTGTCTGGCCCTCTGCCCCGTTCACCATC
Sequence Type mRNA
Unitrap ID UNI2259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127496301..127496342 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 85793934..85793975 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040078 (AC161888.5)  

 
Come back to gene ENSMUSG00000040078


For any suggestions or comments, please send an email to unitrap@crg.es