Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15064D10
Clone ID IST15064D10
Vector VICTR80
Project tigm

Sequence tag IST15064D10HMR1
Sequence
GGCTTGGGCTTGCGGAGCCTTCTAGCACCCCTCGAGGAAACTGCTGTTATTAGGGTGCAGCANTGTACAGTTCCTAACTG
GCGTTGGGCGAGGAGGAAGGCCCGATTCCATTCTCTGGGCTGANGCTTGGCTGTGCGGCACCTTCGTGTCAGGCANTTNN
AGATCTCTCTACTTGGACNAAGTGGTTTTAGGTAGTACTTTGTTTTGTAGTTGGGACTCTTANGGTACATTTCCGGTCGT
CTTCNTCTTTCCACCTTGGTTTTCAAATGTTTCCGTGCGTTTGTGTGCGTTTTGGGTTAGAATCTTGTTGGGAATTTTTG
GGGTCCATCGTGGGTAGGTGCTGTTGCTGATCTGACCTTTTCTCGGGGCAGGATTTAAAANCANTTNATTTGGTTGGTAG
TGGGAANACACATTGGGTAGAN
Sequence Type genomic DNA
Unitrap ID UNI12966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151700427..151700847 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]


Sequence tag IST15064D10BBF1
Sequence
CCTGAAACCCGGCCACCAGGTGGAGGGCCATTTCCACTCGGCTGCCCCGGGTGGCAGGTCACATCCGTCTTCCCCGCCCC
TCGCCCAAGTAATCGGGCCCGCTGCCCGGAGGCCGGGGTTGGACTCGGACTCCGATGCTATCCAGCCCACAGCCTCTAAG
CTCCCGCGGGCCGCTAACAGGAGCCCGACCCGACACCCCGAGCTTCCTCGGCTCTCCCGCCCCGCGTCGAGCCGCGGCCT
CCTCCGCCCACAACGTGCTGGACCCAGCCGCGGCCCCGGCTTTCTCCGCCACGCTTGCCAGGCCACTCAGGGCTGATGCT
GCAGAGCGTAGTCCCCCACGCGAGCCTGTGCCCGAGCCAGCCCACCAGGCCCACGTGCCNCTCACGGAACCGCGGCCGCA
CGCGGAGCCATANNAACCACAGGCGCCATGGCGGCAGANGANGCAGAAAGGGAGGGGGGCGCACTACGCANGCGCNNAGA
NCCCGCAGCGCACAGGGCACGCNAGGNNCCANGCAACTTCAATCNANNAGCCNNTGNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151699890..151700421 500
 
EST/CDNA Est Name
  CV677563.1 - BE992823.1

 
Come back to gene CV677563.1 - BE992823.1


For any suggestions or comments, please send an email to unitrap@crg.es