Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15058F7
Clone ID IST15058F7
Vector VICTR80
Project tigm

Sequence tag IST15058F7HMF1
Sequence
CCCCCAGCTCTGGAGAGTCGGCTCTGCGTCGTGCCGCCATGATGGGCCACCGTCCAGTGCTCGTGCTCAGTGAGTTCAGG
GAAGGGATGTCTCTCTCCGCCCCTCTCTCCCCAAGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI4903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88101120..88101238 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001416 (Cct3) NM_009836 chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]


Sequence tag IST15058F7BBF1
Sequence
CCCCCAGCTCTGGAGAGTCGGCTCTGCGTCGTGCCGCCATGATGGGCCACCGTCCAGTGCTCGTGCTCAGTGAGTTCAGG
GAAGGGATGTCTCTCTCCGCCCCTCTCTCCCCAAGCTGGCCAGTGTTGCCCAGCTCCGTCCCGCCATGACTCGGCCCTCG
TGCCTTCCAGTGGTCTTTTCGCCTTGGACCAAGCTCCTTCCCCACTTTTCTTCTCTTGCCTCTCCTGTCGCCTTCTTTTG
ACAAAATGACTTTCCGCTCTCGGAGTCGCTAGTCTTTACGTGTGCTTCATCCTATTCGCGTTCGGTTCTTTAGTCGCCAC
CCTCCACGCCCCCGTGTCCTTTACAGCATGATTTCCGTGTANATAGTAATGATGGTTCTTANNGGTAGGCCTTGCTTCCT
ATGCTCGGTCCNTCCNTCCGTAGANGCGTGACTTAACGGCAACTCNCTTGANTGATACTTTAGCATCNNTANTTANGANG
CTGNNGTAGANNNGNNNANTNNATNNNTAANAGCTNCCN
Sequence Type genomic DNA
Unitrap ID UNI4903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88101120..88101609 460
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001416 (Cct3) NM_009836 chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]


Sequence tag IST15058F7HMR1
Sequence
GGAATCNGCNNANCCTTCTGGAGAGAANANCANCNAANAANACGCTGCCTCCTCNGGAATGACNCAGAAACCTGCTAACC
TCTGAANTGCCGCCNATCNNNAAACTCATTTTATTGATTGACAAAAACATANGCCAATCGACAGTATTANCCCCGCCCTC
TACGCAAGAAAGGCAAGGCAAGTTAGATAGAGAGGGCATGATGTANGGGACTGGGAGACGCAAGCGCTTGCGCACTGGCG
TGGCCGCTCCCGGCCGCGTGCGGCCANAATGTCTGNNCANNCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001416


For any suggestions or comments, please send an email to unitrap@crg.es