Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10739A9
Clone ID IST10739A9
Vector VICTR76
Project tigm

Sequence tag IST10739A9HMF1
Sequence
TGTTCAGCATTTGAAACGGCTATCTTTGCTGTGCTTTGCCCANCACCAGTACTGCAAAGGACCAGAAACCATCCTTTAGT
GATATCCTGTGTGGAGCCTGATATGATAAAGGCAAGACAGGACAGACTGAAAACAGATCCTCGAGTANCCAGTGGGAGCC
TGCAGTGTTCCAGGGGTCACAGGGAGTCGCACTACACAGGCTCAGAGAGTAAGGTCTCTTACCACTTTCTCAAACAANAA
CTTTGATTAGAAAGAAGTGCANTGATACCANGGAAATCATGTANCTATTCTAAGAAACAAAAAATCCTCTATGTANCCCT
AGCTGGAACTCCTCTGTAGACAAGGCTGACTTGTCTCACAGAGATCCACCTGCTTCTGCCTGCCATGTGCTGAGATTAAA
GGTACTAGCCACCATACCTGGCTAGCTGANCATCTTCTAACTCAGTTNAATTTTGACAGTATCTGGNNGTAGCATCAAAT
TCTCTN

Sequence Type genomic DNA
Unitrap ID UNI13115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71144576..71145060 463
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]


Sequence tag IST10739A9BBF1
Sequence
TGTTCANCATTTGAAACGGCTATCTTTGCTGTGCTTTGCCCANCACCANTACTGCAAAGGACCNGAAACCATCCTTTAGT
GATATCCTGTGTGGAGCCTGATATGATAAAGGCAAGACAGGACAGACTGAAAACAGATCCTCGAGTANCCAGTGGGAGCC
TGCAGTGTTCCAGGGGTCACAGGGAGTCGCACTACACAGGCTCAGAGAGTAAGGTCTCTTACCACTTTCTCAAACAANAA
CTTTGATTANAAAGAAGTGCANTGATACCNNGGAAATCATGTAGCTATTCTAAGAAACAAAAAATCCTCTATGTANCCCT
ANCTGGAACTCCTCTGTANACAAGGCTGACTTGTCTCACAGANATCCACCTGCTTCTGCCTGCCATGTGCTGAGATTAAA
GGTACTNNCCNCCATACCTGGCTAGCTGANCATCTTCTAACTCAGTTCAATTTTGACAGTATCTGGNNGTANCATNNANT
TCTCTAGGANGAANGTCAGTTCACNAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es