Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12032E9
Clone ID IST12032E9
Vector VICTR76
Project tigm

Sequence tag IST12032E9HMF1
Sequence
CCATATGGTATAAATACTGAGGGAGATGAAAGTAACAAGATCACACCGTAGTAAGCAACAGAGTTGAGATTTAAACTCAG
GCTTTCCTGTCTGTGTGTGACACTGCATGGCCTCACCAGTCCCTGAGCGTTTCAGTGCAGACAGCTTCCACTGGGAATAG
AGAAACTGTCATATTTACTCAGTGTCAAAATATTATCTTGTGCTGTGAAGGTTTTGTTGTTCTTGTTGTTTGGGGGGGTC
TCTTGTTTATTTGGTGTTTTGTAAATTGGGAACCTTCAAAGCCTGAAACTATTTCAGGCTGATGTTTTGTTTACCCCAAG
ACCAAGTTACAAGTTTAGGTGAGGGCAGTCAGCGCCAGATGAATGGCTATTCCTGTTGCTGGCTTCTACTGTTTCTTTTC
CNCAAATGCTAAGTTGCANGGGCCANGGGGAGAGCANGGAGTATATCTNTGANTTTGGTAATGGANCTNANCTTTTACTA
NNGANTNTTGANNGGN
Sequence Type genomic DNA
Unitrap ID UNI29852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20645197..20645687 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es