Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P063E10
Clone ID P063E10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P063E10
Sequence
ATAATAACTTTCTATTTCACACAGGGGGAGGGGGCAGCCTCGCTCTGGTCCCTGCGGCTGGCGGCCGAGCCGTGTGTCTC
CTCCTCCGCCGCCGCCATATTGTCTGTGTGAAGCTAGGGGAGCGCGGCTATTGCCGCTGCCGCTTCCACCGCAG
Sequence Type mRNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 158454125..158454252 124
 
EST/CDNA Est Name
  AK146032.1 - BC060742.1 - NM_007788.2 - BC026149.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152052600..152052727 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es