Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12457C10
Clone ID IST12457C10
Vector VICTR76
Project tigm

Sequence tag IST12457C10BBF1
Sequence
TAACCCACTGAAGTATCTCCTTGGTCCATCTGGACACTTAAATAAATGTGTTCTCAGGCCCTGGGATGTTTTGNCCNNGN
TNCAN
Sequence Type genomic DNA
Unitrap ID UNI32198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164579184..164579259 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]


Sequence tag IST12457C10HMR1
Sequence
GGTTATAAGTGTCCAGACTATCTCTAAAAGACAGTATCAGTTCTCTCTTGGAAACTATAATCAGTGTTCCTGTTGTGAGA
GGCAGCTGATGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164579097..164579188 92
NO GENE  


Sequence tag IST12457C10HMF1
Sequence
TAACCCACTGAAGTATCTCCTTGGTCCATCTGGACACTTAAATAAATGTGTTCTCAGGCCCTGGGATGTTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI32198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164579184..164579257 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]

 
Come back to gene ENSMUSG00000017299


For any suggestions or comments, please send an email to unitrap@crg.es