Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12376B6
Clone ID IST12376B6
Vector VICTR76
Project tigm

Sequence tag IST12376B6HMF1
Sequence
ATATGCCTGATAAAGCTTCCCGATGTACTGGGGCTGGTGCCGTAAGATGGAGGCCCCGGACTGCAGGGCACGATTGAGGG
TTTTCTTAGGTTAGCTGAGGTGAGGCTCCCAGAGTGCACATTGTTGGCTTGGGAGAGATGGCTGGAAAATGATGCACACG
TGGCGGAGAGACCACTGACCTCCGCCCCTCTCCCTGCGCCCTCGGGAGGGACCTCTCAGGCCTTCAGGTGTGGGGAGTAA
GTCCAGGAAATCCGTGCAAGCTCAGAGCTACTTTACAGCTGACCGTCNTTCCCAGTATTCCACACAAACGCANCCNCGCC
GGTGACCNTGTTGTTAAAGAGTATTCCTTTAATANTCTGATACTCNCTGGANGTGCNNNTTCNNANACNAAA
Sequence Type genomic DNA
Unitrap ID UNI803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114425131..114425520 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]


Sequence tag IST12376B6BBF1
Sequence
ATATGCCTGATAAAGCTTCCCGATGTACTGGGGCTGGTGCCGTAAGATGGAGGCCCCGGACTGCAGGGCACGATTGAGGG
TTTTCTTAGGTTAGCTGAGGTGAGGCTCCCAGAGTGCACATTGTTGGCTTGGGAGAGATGGCTGGAAAATGATGCACACG
TGGCGGAGAGACCACTGACCTCCGCCCCTCTCCCTGCGCCCTCGGGAGGGACCTCTCAGGCCTTCAGGTGTGGGGAGTAA
GTCCAGGAAATCCGTGCAAGCTCAGAGCTACTTTACAGCTGACCGTCATTCCCAGTATTCCACACAAACGCAGCCACGCC
GGTGACCCTGTTGTTAAAGAGTATTCCTTAATAGTCTGATACTCACTGGAGGTGCCACTTCGGAGACAAAGAGACTCAGC
CTTTGCCAGCAACTCTCAGTTACACACCCTCGGGTGCCAGCCNGCACGAGCCCTACAGGCCTCTTGGAAGTTGCTGTGTG
TGAGGTAGGAGGTGATGTCCCTTCCNATGTCTNNNGGTTTTGCTTGCTCTTGCAGCTGANCNTCGAGCNNNCCAGNCTGN
GGCAGAAN
Sequence Type genomic DNA
Unitrap ID UNI803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114424953..114425520 540
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es