Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11317C1
Clone ID IST11317C1
Vector VICTR76
Project tigm

Sequence tag IST11317C1HMF1
Sequence
CTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTA
TTN
Sequence Type genomic DNA
Unitrap ID UNI14535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7304872..7304950 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47484889..47484967 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 111759919..111759997 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 52406903..52406981 79
NO GENE  

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es