Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14626D11
Clone ID IST14626D11
Vector VICTR74
Project tigm

Sequence tag IST14626D11HMR1
Sequence
ANCTAAGGTTGGGCTTTCTGAATNATTGTATAACATGATGAATCTGGTTGGTGATCAAGTAATATAATTCCNTTTTTGAT
CAAAAAAACAAAATTAAGTTTTTGAATTAATAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84303678..84303791 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]


Sequence tag IST14626D11HMF1
Sequence
GGTAATAGAAATCTTGATAGAATTACAAGAGTTATACATGGGGTGTCTAAAACCAATTTTGAATGAANAGCTCTAAGGCA
GGCATTTATAGCTATGGCACCATTATTTCATGATCTTCCATGATAACTAATTTATCAAGAATAGTGAATATTTCTGTTTT
TTGTACTTTTTTATTTTTCCCTANAATATTTAGTAATACATTAATTACTTTAATAATTNATTCNGGTTTGTGGATCTTAC
CNNATACCANNTTAAAGTGCTTCNAANGTTACNTTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84303791..84304068 256
 
EST/CDNA Est Name
  BY029464.1 - BF721729.1


Sequence tag IST14626D11BBF1
Sequence
GGTAANANAAATCTTGATANAATTACAAGAGTTATACATGGGGTGTCTAAAACCAATTTTGAATGAANAGCTCTANNCAG
GCATTTATAGCTATGGCACCATTATTTCATGATCTTCCATGATAACTAATTTATCAAGAATANTGAATATTTCTGTTTTT
TGNACTTTTTNATTTTTCCCTANAATATTTANTAATACNTTAATTACTTTAATAATTCATTCAGGTTTGTGGATCTTACC
NAATACCACATTAANNTGCTTCAAAGGTTACNTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BY029464.1 - BF721729.1


For any suggestions or comments, please send an email to unitrap@crg.es