Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BB0204
Clone ID BB0204
Vector pGT2lxr
Project sanger

Sequence tag BB0204
Sequence
CTCTCTTCTCCCTCTTATTCCTTATTCTTTTTACCGTTATCCTCCTTCTGTATCTTCATTATCACTCTTCCACTTATTAT
TCTTTCCTCCCTGATTTCTCTCTGTTCTCTCTTTCTCCTTTTTCCTCTTTTTTCCCCTCTTTCCCTTTTATCCCTCCCCC
TCGCTCTCTTCTTTTATTTTATTATTTTATTTTTCTTCTGATTTTCTTTTTTAGCTTTTTGGGAATCCTCAGTCCGGACG
GCGGCTGTGATTGAGAGAGCTGGGGCGTGGAGCAGCAGTGGCGGCGACCGGCGACAACGGAGCAGCCATGAGGGCCGGGC
CCAGTCACCGACA
Sequence Type mRNA
Unitrap ID UNI563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77908191..77908293 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]

 
Come back to gene ENSMUSG00000037750


For any suggestions or comments, please send an email to unitrap@crg.es