Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14734E10
Clone ID IST14734E10
Vector VICTR76
Project tigm

Sequence tag IST14734E10HMR1
Sequence
NNTNATCAATAAAAGTANAAATGTTTTGAAGAATAATCTTTGGTCTTGTTGGTGTTCCTTGGANAATCTCTCCAGCTGGT
AGAAAGTTTTCTTTAGTCTGTGTGGCTGCTGANGCTGANGCGTGTATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI15588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41660222..41660348 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]


Sequence tag IST14734E10HMF1
Sequence
ATATTTTCTGCAATCTCTAGATACTATTTTTTGAATAACCTGGTTTTCTTTATAATAATATAGCATTACATGATTACAGT
GCGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41660350..41660438 89
NO GENE  

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es