Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12497H7
Clone ID IST12497H7
Vector VICTR76
Project tigm

Sequence tag IST12497H7BBF1
Sequence
NTCTGGCTAGCCAGTTTGTTCTGGGAATTTCCAGATCCCTCGATGCTCCCACCACTGAGCCATCTCTCTANCCCTGCATT
ATTTCTCGGATATAAAATCATTTCTTCTAAAATACAGCTTTTGACAGAAAGCTTANAAAGTTGAGTCAGCTATTCAGAGA
CACACGTTTGCTTCTTTAGTTTTCATGTCTTCAGGATTTATTTTATTTTGTTTTTACTTTTGCTTTTTANACTGTGGGTG
AGAACAACTGANGATTGAACCCTGGGCCCCTGTAAGTGTTCTAACAGGGAGCTATACCCCCAGGCTTTTAAAAAATTGTT
TATTTGTAAATGACTTACTTATGTTGATGTGTATGAGTATGTGCCTGCATATATTAATATGTGTGCACATATGTGTGCCT
GGTGCCCGTGAAGTCCAGAAAAGGTTGTCAGATTCCCTCGAACTGGAGTTAGTTGTGAGCTGGTGTGTTGGGTTCTCTGC
AAATGCTCTTAACCNCAANTCATTTCTCTAGCCTCTTANTTTTTATTTTGAANCCNNNTCTCACTN
Sequence Type genomic DNA
Unitrap ID UNI32210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26765938..26766449 490
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054823 (Whsc1l1) NM_001001735 Wolf-Hirschhorn syndrome candidate 1-like 1 (human) Gene [Source:MGI Symbol;Acc:MGI:2142581]


Sequence tag IST12497H7HMF1
Sequence
AAGGAAAGAGCCTATTTCACCTTCCAGTTTACATTCTATCTTGAAAAATCAGGGCAGAAACTCAAGGCAAGGACTGAAGG
GGAACCACGGAGGAGTGCTGCTCCCGGGCTTGGCATATGACAGAACTACCTGCCCAGGTAGTATTACTTACTTACATTAT
TAAATCANAAAGCGTTTCTTANGAGAGAAATTAAGGTGGCNCNTTNGTNGGTTAGAAANGGNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75284675..75284895 207
NO GENE  

 
Come back to gene ENSMUSG00000054823


For any suggestions or comments, please send an email to unitrap@crg.es