Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14758D11
Clone ID IST14758D11
Vector VICTR76
Project tigm

Sequence tag IST14758D11HMR1
Sequence
TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTGTT
Sequence Type genomic DNA
Unitrap ID UNI31803 UNI32213 UNI32214 UNI32215 UNI32216

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161906: 25798..25865 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161916: 681774..681841 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 320342..320409 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 411295..411362 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 43303624..43303691 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074852 (Hpse2) NM_001081257 heparanase 2 Gene [Source:MGI Symbol;Acc:MGI:2685814]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 28587164..28587231 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25117198..25117265 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038002 (Cramp1l) NP_065633 Crm, cramped-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1930190]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55295444..55295511 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8314403..8314470 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022141 (Nipbl) NM_027707 Nipped-B homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913976]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 31783478..31783545 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 94895827..94895894 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77575076..77575143 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123556108..123556175 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036814 (Slc6a20a) NM_139142 solute carrier family 6 (neurotransmitter transporter), member 20A Gene [Source:MGI Symbol;Acc:MGI:2143217]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56233984..56234051 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 44982987..44983054 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6252002..6252069 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18956386..18956453 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19240959..19241026 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070796 (AC165084.6) NM_027403 pregnancy-specific glycoprotein 21 [Source:RefSeq peptide;Acc:NP_081679]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 68628541..68628608 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 111866290..111866357 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 64274569..64274636 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 55425137..55425204 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6998778..6998845 68
NO GENE  


Sequence tag IST14758D11HMF1
Sequence
AAACAAATAAAATTAGTCCGGGCAGTGGTGGCACATGCATTTAATCCCAGCACTTGGGAAGCAGAAACAGACAGATTAGG
GTTCAAGGCCAGCCTGGCCTACAGAGTGAGTTCCAGGACAGCCAGTGTTACACAGAGAAACTGCATCATGAAAAAGAAAC
AAAAAACAAAAATGAATTAAATAAATACAATTAAAAAATTAAAAAATTAAAAAATACCGGGGAGTGGTGGCTCAAGCTTT
TAATCCCAGCCCTAGGGAGGCAGGGATGGGAGGATTTCTGANTTTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000070796


For any suggestions or comments, please send an email to unitrap@crg.es