Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P026B12
Clone ID P026B12
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P026B12
Sequence
GGGGGTCGCGGTCAGCCCACGCCGGGGTTGAAGCTGCCGGGCGCCTTCCTCTTGCATCGCGGCTGCAGCTTGCTTCTGTT
CCCGCGCCCGCTTGCACATCCTCCTGCTCGCGCGGTCCTGCTGCCGTCCGGTGCTCCCCGTAGCCGCTCAGGCAGAGAG
Sequence Type mRNA
Unitrap ID UNI10643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77765179..77765333 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032349 (Elovl5) NM_134255 ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI (curated);Acc:Elovl5-001]

 
Come back to gene ENSMUSG00000032349


For any suggestions or comments, please send an email to unitrap@crg.es