Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14172D9
Clone ID IST14172D9
Vector VICTR74
Project tigm

Sequence tag IST14172D9HMF1
Sequence
ATCTTAGTTATCTTCGCTGAGAAGAAATCGATCCTGAGATAAGCTGATACGCAGAATAATTTATTAGATGTCTCAAGTGG
CAAAACCCCAGCTTTGCGAGGGGAGAAAGAATGTGACTTAAGTATCTGTTCTTAAAAGCAGTAAAAATAGCCTAAGAGAA
CTATTAACCTCAAGGATAAATTAAATGTATACATTTGGTGGGCCCAAGTATGTGGTAAACCTTAGTATAGTAGGGTTTTN
CTTTTGTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30987392..30987653 260
 
EST/CDNA Est Name
  BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407.1 - BY015615.1 - BY127928.1 - BY338249.1 - BY343807.1 - BY220999.1 - BY342669.1 - BY223600.1 - BY336736.1 - BY221806.1 - BI133911.1 - BQ900760.1


Sequence tag IST14172D9HMR1
Sequence
GATTTAAAAATATTTACTTTAGGAAAGATATACGTGGAAATTCCTGTAAGTGTTTAGACAAAGGCATTTGGATTGCCTGA
GTGTCTGTCAGTATATAAATAGAAATTTCACCATGGCTCTGAATTTTTAAAATTACCTTTGTGTGTGCACAAGTGTGTGT
GTGTGTGTGTGTGTGTGTGGNNANANCN
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30987215..30987394 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14172D9BBF1
Sequence
ATCTTAGTTATCTTCGCTGANAANAAATCGATCCTGAGATAAGCTGATACGCAGAATAATTTATTAGATGTCTCAAGTGG
CAAAACCCCAGCTTTGCGAGGGGANAAAGAATGTGACTTAAGTATCTGTTCTTAAAAGCAGTAAAAATAGCCTAAGANAA
CTATTAACCTCAAGGATAAATTAAATGTATACATTTGGTGGGCCCAAGTATGTGGTAAACCTTAGTATAGTAGGGTTTTG
CTTTTGTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30987392..30987656 257
 
EST/CDNA Est Name
  BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407.1 - BY015615.1 - BY127928.1 - BY338249.1 - BY343807.1 - BY220999.1 - BY342669.1 - BY223600.1 - BY336736.1 - BY221806.1 - BI133911.1 - BQ900760.1

 
Come back to gene BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407.1 - BY015615.1 - BY127928.1 - BY338249.1 - BY343807.1 - BY220999.1 - BY342669.1 - BY223600.1 - BY336736.1 - BY221806.1 - BI133911.1 - BQ900760.1


For any suggestions or comments, please send an email to unitrap@crg.es