Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10653E5
Clone ID IST10653E5
Vector VICTR76
Project tigm

Sequence tag IST10653E5HMR1
Sequence
CTCTCTCTCTCTTTCTATTTTGTGTGTGTGTTTGTATATGTANGCATGCATATATGATACACCCCCACCCCATCCCAGTA
NTATATGGTGAGCTAAGTAAACAAAATGATCTTTTAATGGATAGCCAGTGAATGGAAGACTAAGTCTTCTTGGAAATGGG
GGTGGAGGTAAGAGAAAAATAAAAGAGAATAAANNTAANNTATTTCAAACTATATTC
Sequence Type genomic DNA
Unitrap ID UNI29961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53644700..53644915 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]


Sequence tag IST10653E5BBF1
Sequence
GCAACAAATAATTTTATGGTTGGGGATCACTACAACATGATGGATTGTATTATAAGGTCACAGCATTAACAAGGTTCTCT
ACTAAACTAGAATAACAATTTTTGGTTTTTCCAAGACAGGGTTTCTCTGTGTAGCCCCAGCTGTCTTGGAACTCACTGTG
TANAACAGGCTAGCCTCAAACTCGGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17244246..17244437 190
NO GENE  

 
Come back to gene ENSMUSG00000042195


For any suggestions or comments, please send an email to unitrap@crg.es