Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P026A01
Clone ID P026A01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P026A01
Sequence
GGGGAGATAGATGGTAATTGCGGGTGCGCGGCCGCTGCCCGTGCAGCCAGAGGATCCAGCACCTCTCTTGGGGCTTCTCC
GTCCTCGGCGCTTGGAAGTACGGATCTTTTTTCTCGGAGAAAAGTTCACTGGAACTGGAAGAAATGGATTTATCTGCCGT
CCAAATTCAAGAAGTACAAAATGTCCTTCATGCTATGCAGAAAATCTTAGAGTGTCCGATCTG
Sequence Type mRNA
Unitrap ID UNI10449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101410329..101413202 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es