Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14744C4
Clone ID IST14744C4
Vector VICTR76
Project tigm

Sequence tag IST14744C4HMR1
Sequence
TGATGAGATCCTGCGAGAGAGGAATGAAGGACGTGATGGGTGACTGACTTGGTTGGTGCAGTTTGTGAGTACATTTCTGT
GGGAAACCAAATAAAAC
Sequence Type genomic DNA
Unitrap ID UNI16292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54047717..54047813 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004633 (Chn2) NM_023543 chimerin (chimaerin) 2 Gene [Source:MGI (curated);Acc:Chn2-001]


Sequence tag IST14744C4HMF1
Sequence
ATCACAAATGGAAGTGCATGTGATTCCTAACAAGCACTTCTGGGAGGGCGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54047669..54047720 52
NO GENE  

 
Come back to gene ENSMUSG00000004633


For any suggestions or comments, please send an email to unitrap@crg.es