Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P025G09
Clone ID P025G09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P025G09
Sequence
CCCTTCCCTCGCCATCACACTGACATGAGTGTGGGTCTTCCTGGTCCCCACAGTTTGCCTAGTTCTGAGGAAGCATCGAA
TTCTGGGAACGCCTCATCAATGCCTGCAGTTTTTCATCCCGAGAACTATTCTTGCTTACAAGGGTCTGCTACTGAGATGC
TCTGCACAGAGGCTG
Sequence Type mRNA
Unitrap ID UNI10653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122657777..122657951 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]

 
Come back to gene ENSMUSG00000012396


For any suggestions or comments, please send an email to unitrap@crg.es