Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P025G05
Clone ID P025G05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P025G05
Sequence
GCCGCTGCCCGTGCAGCCAGAGGATCCAGCACCTCTCTTGGGGCTTCTCCGTCCTCGGCGCTTGGAAGTACGGATCTTCT
TTCTCGGAGAACAG
Sequence Type mRNA
Unitrap ID UNI10712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101413083..101413176 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es