Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13291A11
Clone ID IST13291A11
Vector VICTR74
Project tigm

Sequence tag IST13291A11HMF1
Sequence
TGACTGGTGTAAGGTGGAATCTCAGGGTTGTTTTGATTTGC
Sequence Type genomic DNA
Unitrap ID UNI31091 UNI32226 UNI32227 UNI32228 UNI32229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166387: 2413..2453 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 168769..168809 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079834 (Tmlhe) NP_620097 trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166412: 39296..39336 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166422: 277996..278036 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166351: 255272..255312 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166404: 415578..415618 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 376870..376910 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 18145178..18145218 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 7385348..7385388 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057440 (Mpp7) NP_001074756 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) Gene [Source:MGI Symbol;Acc:MGI:1922989]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14070077..14070117 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15412919..15412959 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 19486905..19486945 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4472779..4472819 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 28786436..28786476 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11260443..11260483 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020193 (Zpbp) NM_015785 zona pellucida binding protein Gene [Source:MGI (curated);Acc:Zpbp-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7099489..7099529 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047193 (Dync2h1) NM_029851 dynein cytoplasmic 2 heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:107736]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14148757..14148797 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056296 (Synpr) NM_028052 synaptoporin Gene [Source:MGI (curated);Acc:Synpr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27507384..27507424 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28749436..28749476 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 10613135..10613175 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5800146..5800186 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 12778880..12778920 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 13346392..13346432 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10048765..10048805 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 41089196..41089236 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 19153552..19153592 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 5418466..5418506 41
NO GENE  

 
Come back to gene ENSMUSG00000056296


For any suggestions or comments, please send an email to unitrap@crg.es