Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12351D6
Clone ID IST12351D6
Vector VICTR76
Project tigm

Sequence tag IST12351D6HMF1
Sequence
NGANTTAAATTGGAGTTTAAGGATGTTTCTGTTTTGCANACCTGAACGGCTGGGAAGTAATTGAGCATCTAGATGATANA
TAGAACTCTGGGGCTTTCTGTTTAAATGTAAAAGTTGGGAGTTCTTAAAACAGTTTTCCTGTATTTTCTCCAGGCAGTTT
CTTTTCTACATTCTGTTTATAATAGACTTGGCTTTTCCGTTGGGAATTTCCAGAACCTTATATAGTTCCGAATAAATCTT
GCCGGGAGGGTGGGTGGCTGCAGACTGATGCCAGCGCTCCTCANCCCCTCTCACTGCANACTGTCCGGGCACCTACCACA
CAATCTCGAACCGCCCCTCCCTACCCGTCCAGGTTCATGGAAGGGCCAGTTANTTACACAAAGATGTGCAGNGNNNNTGC
ACAACAGCGCGTGGGAGTGGGGATTATGCACN
Sequence Type genomic DNA
Unitrap ID UNI29474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20442062..20442490 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST12351D6BBF1
Sequence
AGAGTTAAATTGGAGTTTAAGGATGTTTCTGTTTTGCAGACCTGAACGGCTGGGAAGTAATTGAGCATCTAGATGATAGA
TAGAACTCTGGGGCTTTCTGTTTAAATGTAAAAGTTGGGAGTTCTTAAAACAGTTTTCCTGTATTTTCTCCAGGCAGTTT
CTTTTCTACATTCTGTTTATAATAGACTTGGCTTTTCCGTTGGGAATTTCCAGAACCTTATATAGTTCCGAATAAATCTT
GCCGGGAGGGTGGGTGGCTGCAGACTGATGCCAGCGCTCCTCAGCCCCTCTCACTGCAGACTGTCCGGGCACCTACCACA
CAATCTCGAACCGCCCCTCCCTACCCGTCCAGGTTCATGGAAGGGCCAGTTAGTTACACAAAGATGTGCAGGGCTGTGCA
CAACAGCGCGTGGGAGTGGGGATTATGCACAAGGGAAAAGGTGTGTGTTTTTTAAAATGAAAAAAGGAAGTANCACATGA
CTCATCCNCACTGAAAATGCNAAGCCAANCCNNAN
Sequence Type genomic DNA
Unitrap ID UNI29474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20442061..20442571 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es