Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14141E7
Clone ID IST14141E7
Vector VICTR74
Project tigm

Sequence tag IST14141E7BBF1
Sequence
NAAGCAGGCGAATATCTGAGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAAC
CCTGTCTGTGTGGAAAAACAAAACAAAACAAGTCCTGACTTTCANTCATTGCCCAAGGACCATCANATGANAACAAAATC
CTCCCAACCCCTCANCCCAAAAAGCCCCCTCTCTTTATCTTTGGATGTTTTCCACTCTTTTGACTCTCAAGGGGAAAAAA
AAAANNNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50146823..50147065 235
NO GENE  


Sequence tag IST14141E7HMR1
Sequence
CTGCCTCACAAGTGCTGGGATTAAAGGTGTGCNCCACCACTGG
Sequence Type genomic DNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50147066..50147108 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]

 
Come back to gene ENSMUSG00000073207


For any suggestions or comments, please send an email to unitrap@crg.es