Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10762B9
Clone ID IST10762B9
Vector VICTR76
Project tigm

Sequence tag IST10762B9HMR1
Sequence
TNANNAAAGTTTTAGTGTTTCCTTTCATAAAAATGTTACTTTCTGGATTTGTTTCNGTACTGGGAATGGAAGCCAGAGCC
TTGCACATGGTANACAANCACTTTTCCACTGAGCCATCTCCCCAGCCCTAAAATGTTTCATGAAAGTCTTATAAGGGTTT
TCTTCTTGTTTGCATATGTGTTCATAGGTGTGCATTTGTGTGAGTATGTGATGTACATGTGCAGGAGTTTGGAGACCANG
GATCANTGTTGCTCGTCTTCCTCCATCACTTGTCCATGTAACTCTGCCAACAGGGTCTTTTACTAAAAGTTGANCCTGCT
GACTGGCTCCNNGGCC
Sequence Type genomic DNA
Unitrap ID UNI19866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7745638..7745967 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039201 (Tbc1d25) NM_172478 TBC1 domain family, member 25 Gene [Source:MGI (curated);Acc:Tbc1d25-001]


Sequence tag IST10762B9BBF1
Sequence
ATAACCTGAATGTGGTGTTTTATACTTGGAATCTTAGCACCTAGAAGGAAGGCCAAGGCAGCCTGAACTATACAGTTAGA
GCCTGTTAGGAAACAAAGGAAAGGAAGGCCCCACACAGCCAGTGAGATGGACCAACAGGCAGAGGTGCCTGTTACCAAGT
CTAGTGACCTGGTTCAACCTGCAGAACCCACATGGTGGAAGGACAGCATCCCACAAGTTGTCCTCTGTGTACCATGCATG
CCATGGCATGCAGGTGCATGTGAGCCCATGCAGCATGGCTCAGTAGGTTGATGAGCTAAATTCAATCCCCAANACTCCCA
CGAGAGAAGGAAGAACTGACTTCTGAAAGTTGTCTTCTGACCTACACATGCATTCTTTGGTATGTCTGTGGACACACACA
CACATATACAAAATAAGTATCATACANGTTTAANGCAGCTCATTTTTGTGTCCTCCCATGGCTTCANGGAGCTGTTTTTT
TCTCTCCATCAATTTTGCTTGCTAGTCCTTTTAAGGACATTTGTAAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7745969..7746496 520
 
EST/CDNA Est Name
  BI557252.1 - BY734783.1 - BB657626.1 - BE983467.1 - CA328901.1 - BU707689.1 - BB636170.1 - BE335324.1 - BF462074.1

 
Come back to gene BI557252.1 - BY734783.1 - BB657626.1 - BE983467.1 - CA328901.1 - BU707689.1 - BB636170.1 - BE335324.1 - BF462074.1


For any suggestions or comments, please send an email to unitrap@crg.es