Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10408A2
Clone ID IST10408A2
Vector VICTR76
Project tigm

Sequence tag IST10408A2HMR1
Sequence
TGCTCACGGCCTGTCTAGTGTAGGTAAACAGAAAATGTATGCTGTGCTTTATGGAGAAAGTATGTANAAAGCTTCATTCC
ANCACTACGTATAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI32234

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21164105..21164202 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST10408A2BBF2
Sequence
NGCACTAAGCTACAGATCATTCCAAACAGCNNCATCTCCAACACAAACAACAACAAACCANAATGCNTAACATTAAACAG
GCTCCATAAACAGTATTGCTTNCNNGANCTGAACAAAGAAGACTGAGCACTCACAGNTANGAACACCTGTGTTATACAAC
TCAAATTTTTTTACTACTCTGCACACACCTGCAAATACCACCAAANTACAACAAATATTTNACTNNGNAGCTAAAATACN
TTTNANGGAATAANAATTTTTGCAAATACATAATCTGTCNNTAGTGAGAACTGATTACACTANNNNTTAACTAANCAGTT
TTTNNNNTGCACTCCAATTNTNAATACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10408A2HMF1
Sequence
CAACAAACTCAACCAAACAATCAAACAAAAACCACTGGAGGGATGGCTCANTGGTTAAAAGCACTGACTGTTCTTCCAAT
TCCCACCNCCCATAGGGTGGCTCACCACTGTTTGTAACTCCAGCTCCAGGGGATCCAAGGCCCTCTTTGGGTCTCTGTGG
ACACCATCCGTACAAGTGGTGCATACATGTACACATTAATTTGAGGGGGGACTGGAGATACATGCATATATTAATTTGGG
GGGACTAGAAAGATGGCTCANAGGCTGANTACTGGCTCTCTCCCANAGCACCAGCGCTTGGTTCCCANAACGCACTTCAN
GCAGCTCACCGCCATCTGTAATTCCNGCTCCTGGGATCTGATGCCTTTGGCCTCTAAAAGCACCTGCATTCTTGTGCANA
TACCCACGTGCAGATACCCACGTCCATACACAGTTCGAAATAATAACANATCATTTTTTTTNAAAAATATGACCNAGATA
AGGGCCAAGTTGNNNATNANAANGCTGGCANTAAACAAGACTGTGCTGGCNAACTTTACA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33018534..33019072 499
 
EST/CDNA Est Name
  CF533090.1 - BY719028.1 - BY320686.1

 
Come back to gene CF533090.1 - BY719028.1 - BY320686.1


For any suggestions or comments, please send an email to unitrap@crg.es