Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14425A1
Clone ID IST14425A1
Vector VICTR74
Project tigm

Sequence tag IST14425A1BBF1
Sequence
CTCAGGAAACAATATAAATAAAACCACGTGCGGCCGCGGCCGGGGAGGCAGCGCGGAGCCCCCANCTGGCCGCANCTCGG
ACAATGGCATGAACTGGGCTAGTGGTCANCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72655480..72655594 109
NO GENE  


Sequence tag IST14425A1HMR1
Sequence
NAGTGGCAGCCTCTCCACGCAGGGGGGCGCCGCGGTTGCGCGCCGTTTCCAGGGTTTGCAGTGGGGTTCCTCCAGGTCTC
GGT
Sequence Type genomic DNA
Unitrap ID UNI16842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72655593..72655674 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]


Sequence tag IST14425A1HMF1
Sequence
CTCAGGAAACAATATAAATAAAACCACGTGCGGCCGCGGCCGGGGAGGCAGCGCGGAGCCCCCAGCTGGCCGCAGCTCGG
ACAATGGCATGAACTGGGCTAGTGGTCAGCGGATCCAGGGAGACTCGGCCTCGGCCTCGGAGCGCTCCGAGAGCGCATCC
GGAGAGAACCCTGGCCANCCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72655415..72655594 178
NO GENE  

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es