Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14461E8
Clone ID IST14461E8
Vector VICTR74
Project tigm

Sequence tag IST14461E8HMF1
Sequence
AGAGCGCACCCCACGGTGTCTGGAGAGCGCGGTCGGCAGCGGCAGCGCAACCCCTGAGAGTTCCAGGGCGCATGTGCGGT
ACCGCGCGGTCTGCGACCCAGGACGGTGGGGGGTGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI32238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11635239..11635357 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031508 (Ankrd10) NM_133971 ankyrin repeat domain 10 Gene [Source:MGI Symbol;Acc:MGI:1921840]


Sequence tag IST14461E8HMR1
Sequence
CTCTGACCCTAACAGCACACCACGCGGAAAATGGCGCCTTAAAGTGCCCGCGCCCACCTTGCCGAAGTGCNCANCCCANT
GCACNGNCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11635354..11635437 78
 
EST/CDNA Est Name
  CB599128.1 - BM950904.1


Sequence tag IST14461E8BBF1
Sequence
AGANCNCACCCCACGGTGTCTGGANANCNCGGTCGGCANCGGCANCNCANCCCCTGANANTTCCAGGGCNCATGTGCGGT
ACCNCNCGGTCTGCNACCCAGGACGGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene CB599128.1 - BM950904.1


For any suggestions or comments, please send an email to unitrap@crg.es