Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P025A04
Clone ID P025A04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P025A04
Sequence
AATTACCCTCTAAATGCTTAATTCTTCAAACTGCTCAAGTGTCACGCGTGCTTAGCTGCTCCATGTCACCACCAAGAACT
TAGCCGGGAGTGGCACTACG
Sequence Type mRNA
Unitrap ID UNI11610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73586225..73586324 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es