Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11715A9
Clone ID IST11715A9
Vector VICTR76
Project tigm

Sequence tag IST11715A9BBF1
Sequence
CTAGTTAGTGTCCTANAAGAGCTCACGGCTTANTAAATGATGAGTAGTTACCCNNGTAACCAGTCTGCCTGGGGGTCAGG
TAGGATTCTATAATGTANGCTCTANAGCAAGGGTAGTAANACTGGGGTGCATTCNNTACAGGGAGTANGGAGTGCTGGCC
ACCCTANCTTANGGACTANTTTANAGTTAAAGAAGAGGTATATTGGGGTGATCTAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11715A9HMF1
Sequence
CTAGTTAGTGTCCTAAAAGAGCTCACGGCTTAGTAAATGATGAGTAGTTACCCAAGTAACCAGTCTGCCTGGNGGNNNGG
TAGGATTCTATAATGTAGGCTCTANAGCAAGGGTAGTAAGACTGGGGTGCATTCAGTACAGGGAGTAGGGAGTGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI8596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82965615..82965772 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]

 
Come back to gene ENSMUSG00000038172


For any suggestions or comments, please send an email to unitrap@crg.es