Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P024H02
Clone ID P024H02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P024H02
Sequence
AGAGNNNNGGGCGTGGAGCAGCAGTGGCGGCGACCGGCGACAACGGAGCAGCCATGAGGGCCGGGCCCAGTCACCGACAT
GTGAGCCACTGCTTCATGTTGTGCTGATGCTGGTCTGCCATGCTAGCCTGTCTCCCAGGACCAGGTGACCTGTCCCTTCA
GCTTCTTTCTCACACGCAGATGAACACTGGACTTCAGAAAT
Sequence Type mRNA
Unitrap ID UNI4541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77908223..77956716 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]

 
Come back to gene ENSMUSG00000037750


For any suggestions or comments, please send an email to unitrap@crg.es