Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P026E01
Clone ID P026E01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P026E01
Sequence
CCTTTTGGACAAGAAGAGTTTGAAGATCTCTGGAATTAA
Sequence Type mRNA
Unitrap ID UNI11533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140906933..140906971 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056076 (Eif3b) NM_133916 eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]

 
Come back to gene ENSMUSG00000056076


For any suggestions or comments, please send an email to unitrap@crg.es