Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10990C5
Clone ID IST10990C5
Vector VICTR76
Project tigm

Sequence tag IST10990C5BBF1
Sequence
ACACTTGTACAGTTGGATGGGAGGCAGAAACAGGAGTCTCTGGAATCTATTTTTTAATTTAATTATTTAGTTTGTGGGCC
AGCTAGCATGGCAGAAACAACAAGGGTGATCCTACCTTAACAAGGAGAAAGGAAAAACCTGACTCCCTAAAGTCTTCTGA
CCTTCACACTTGTGTCACCCCCTCCTNACATACAAGAATAAGTAAAATTTCTANAATGTTCCATCATATGAATTTGTCAT
TATTATAGAAACAGTTTGCTATTACTGTGTCATTTTGCCTTCCTGAATTCTTGNCNNCNNNNCNTAAAAAAGCTGTGTGA
AAATAGTGTGAGAAGCCGANAACATAGCACAGTGGTAGACTGNTTGCCTATCACGTGCATGGCCCTANGTNTGAATTTTG
ACATCNNANAAAAGAANNTTGTGGGCNTCGTGATTTNTTCTGTTGTTCACTGGCTCCTTTTTCTGGAGTAGAAATCTGAT
NNCACATTNGGGANCCNGANNAGCTNACAGNCAGAAAACNTAACTNTTNNTTTTTTT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10990C5HMF1
Sequence
ACACTTGTACAGTTGGATGGGAGGCAGAAACAGGAGTCTCTGGAATCTATTTTTTAATTTAATTATTTAGTTTGTGGGCC
AGCTAGCATGGCANAAACAACAAGGGTGATCCTACCTTAACAAGGAGAAAGGAAAAACCTGACTCCCTAAAGTCTTCTGA
CCTTCACACTTGTGTCACCCCCTCCTCACATACAAGAATAAGTAAAATTTCTAGAATGTTCCATCATATGAATTTGTCAT
TATTATAGAAACAGTTTGCTATTACTGTGTCATTTTGCCTTCCTGAATTCTTGTCAACG

Sequence Type genomic DNA
Unitrap ID UNI15804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29737200..29737497 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029772 (Ahcyl2) NM_021414 S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI (curated);Acc:Ahcyl2-002]

 
Come back to gene ENSMUSG00000029772


For any suggestions or comments, please send an email to unitrap@crg.es