Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14772D10
Clone ID IST14772D10
Vector VICTR76
Project tigm

Sequence tag IST14772D10HMR1
Sequence
ACAACATAATAGCCTAGTTATTCTCTGGGCTAGCCGATATATGATTTCTAACTTTTTTGTGTTTTACTTGTTTCTGGGCC
CTGTACAGGGTNNANAGAAGGCTTCTTGCTTTCTGGTGGCAATGCACTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI32135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71597387..71597518 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032232 (Cgnl1) NM_026599 cingulin-like 1 Gene [Source:MGI (curated);Acc:Cgnl1-003]


Sequence tag IST14772D10BBF1
Sequence
GTAAGCAATGACATTTTGATAAAGTTTTATACTGTATGTAAAGTCAAACAAGTAACCGAGGACACGCCGTCCATCTGTCG
TCATGGTTTAGAACTGAGTGAGCAAGCATCTCTGTGGCTATCTGATGACTGCACTGCAGCTTGTGCTTGCCGGTTTTTAA
GCACAGTTAAAACCCTGAGGATCGGGCAGGCGTCTGGTTCCTGGAGATATCCCGGATTTTTAGTTCCCACCTTGTTCCCC
CTTCCCCGCTACATACACTGTCCCCTAACACCCATTACCAAGATACACCACCTGGTAATGACTGCAAAATGAACTCCACG
GCAAGTCCTGCCTGCTCCTCTGGGCTTCTCACCAGCATCCTTCTTAGAACCCTCAATAGGCTCTTANCTGCCAGCTGAAT
GAACCCTTGAGAGGATTTGCAAAGTCCAAGCCCCGCCCACCCATCNNCACCACCCCTAAGAATACTTCCTCCCTCCCCCT
CAATTCAGCTTCTTCAGCTCTCTTGCAGTTCCCTGAACNCCAGCAATTCTCCTGCCCTTTGANNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71597517..71598058 534
 
EST/CDNA Est Name
  BB667316.1 - BI156510.1 - BG924083.1 - BI685161.1 - BB647549.1 - BB663974.1 - CJ139775.1 - BB619191.1 - BB629895.1 - BB636704.1 - CJ112292.1 - CJ116891.1 - BE989168.1 - CJ122211.1 - CJ116226.1 - BB847193.1 - BY207956.1 - BY299930.1 - BY199737.1 - BY184213

 
Come back to gene BB667316.1 - BI156510.1 - BG924083.1 - BI685161.1 - BB647549.1 - BB663974.1 - CJ139775.1 - BB619191.1 - BB629895.1 - BB636704.1 - CJ112292.1 - CJ116891.1 - BE989168.1 - CJ122211.1 - CJ116226.1 - BB847193.1 - BY207956.1 - BY299930.1 - BY199737.1 - BY184213


For any suggestions or comments, please send an email to unitrap@crg.es