Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13748C8
Clone ID IST13748C8
Vector VICTR74
Project tigm

Sequence tag IST13748C8BBF1
Sequence
TTAACTGTTGTCTCTGCATAACTGCAGGCTTCTATTCTCTTTCATCTTTACTACTCTACCCTAGGTCCCTTAGGAGGAAC
CCCTTGAGCTACCCGGTCTAAAACACGTTATCGCCAGTGTGAGGGCTAAATGGTGTGATAACACCCAAGAGCCAGGAAAT
GGCAACAGCCTTGGAGCCAGAGGACCAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI26463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 39176296..40014912 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025602 (Zfp202) NM_030713 zinc finger protein 202 Gene [Source:MGI Symbol;Acc:MGI:1933401]

 
Come back to gene ENSMUSG00000025602


For any suggestions or comments, please send an email to unitrap@crg.es