Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14134D5
Clone ID IST14134D5
Vector VICTR74
Project tigm

Sequence tag IST14134D5BBF1
Sequence
TGGGCACCTGTCCTCCGGTCCGGANNGNGNCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCTCAGCGCCTCTGTGCTTC
CGCCTGTTCCAGAAGCTGTCAGGTTCTCTGGCGCACCNTG
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI10320 UNI31253

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647894..20648010 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10881932..10882048 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 19241012..19241128 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 47137563..47137679 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 42482032..42482148 109
 
EST/CDNA Est Name
  DT915661.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 16483324..16483440 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 38775312..38775428 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74120607..74120723 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 55485601..55485717 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35521478..35521594 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56007561..56007677 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15652536..15652652 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11919851..11919967 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029629 (Phf14) NM_029404 PHD finger protein 14 Gene [Source:MGI (curated);Acc:Phf14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 67307770..67307886 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047370 (AC046145.16)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6742078..6742194 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 58237743..58237859 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 17283672..17283788 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 56719366..56719482 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 94731383..94731499 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 96626151..96626267 109
NO GENE  


Sequence tag IST14134D5HMR1
Sequence
NCAGCAGCGGTCGCCATCTTGGTCCCGGGACTCCNAGGAACTTAGGAATTTAGTCTGCTTAGGTGAGAGTCTGTACCACC
TGGGAACTGCCAAAGCAACACACTGTCTGAGAAAGGCCCTGTTTTGGGCCTTCTTCTTCGGCCAGGAGGAGGTCCAAATA
CAAGATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCNGCAGAGAGTGCTCTGANCACTGAAACTCANAGGANAGAATC
TGTCTCCCAGGTCTGCTGATANACNGTAACAGAATCACCAGAAGANCAATCTCTAANCAGANTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3385136..3385438 283
NO GENE  


Sequence tag IST14134D5HMF2
Sequence
TGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCACAGCGCCTCTGTGCTTC
CGCCTGTTCCAGAAGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTGTTCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3384975..3385106 132
NO GENE  

 
Come back to gene ENSMUSG00000047370


For any suggestions or comments, please send an email to unitrap@crg.es