Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10080B2
Clone ID IST10080B2
Vector VICTR75
Project tigm

Sequence tag IST10080B2BBF1
Sequence
ATATATGTAACCTAAAGCTCTCCACTTTAACCTTTGTATGGTTTTTTTGAGACAGGGTCTCTCTGGGTAGCCTTGTCTGT
TCTGGAACTTGCTATGTAGCCCAGGCTAGCCTTGTTAGTACTATTGCGTCAGTGTCATAAGTGCCAGGCTTATAAGGCAA
GAGCCACCATGGCTATGTTCACATTGCTGTCCAGCAATCTCGGGATCTTCCGCCTTCCCTAATTGATAGCCTATTACCAA
GTAACCAGCTTTTGCTGTATTATTTTATCTTAAGGCATTTTATTTTGTGTATTTTCATAATGCAAAATAAGGGACTTTTT
TATTTTTTTAAAGGCAAGGTCTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26652964..26653312 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]


Sequence tag IST10080B2BBR1
Sequence
ATATCTGGACCTAACTCGCTCCACAAACTACAAGACCACGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26652927..26652967 37
NO GENE  

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es