Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14795H1
Clone ID IST14795H1
Vector VICTR76
Project tigm

Sequence tag IST14795H1HMF2
Sequence
TTAGTACACGAATCAACCCCAACAACGTAGTTTCATCTCTCCCGTCCTTCCCGATCCCTGAGAGACTGTGGCCCCCAGTG
CTCATCTCCCTCCTTTTGCAGATGCCCCCCAGCAGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI13008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138038526..138038643 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]


Sequence tag IST14795H1HMR1
Sequence
AAAGAATAACCCTTCAGCCTGAACCTGGTCCCTGGGCAGCTCTGTCACCTTGGGTAAAGCTTAATTCCACGTCTCACACC
ACAATCTCCTCATCTGTGAAGCANAGAAAAACCAATCCATTTTCTGCTCACTGTGTTAGTGGGAAGTGGGACCCGAGAGG
CCANTGCTTANAATTCGGAGGCTTTTCCTTCTCAGCGACCAGGGACCAATTCTCCCATGGTGGATCCAGATGACCATCAA
TCGCTTGTTCACTAANACTCTTTCAAACTCTGCGTTTGGCTGCACTTGCTCCCTGGAGCCTTCCCCCTCAGTAGGCANGG
ACAGAGGTTANGACTCACCNNACACCCANGGCAGGAAGGGCTCAAGTCATAAGTTCCATATGGGACTGTGCNNNAGGTGA
CACCGATGCCGTGGTGCNNACNGGAANCTGCNCCTCCTTCACTCTGTTCCTTATTTTCATTATTTTCTNNANNNTCNNTC
NNNNANCTGCTTCANTGGAANTGCNCCNANANCCAAGACTCNNNGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037221


For any suggestions or comments, please send an email to unitrap@crg.es