Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10075H2
Clone ID IST10075H2
Vector VICTR75
Project tigm

Sequence tag IST10075H2BBR1
Sequence
GTGGAGGACATGGGGAGAAGAAAAAGTTAAGGCAAAGATGGGTTGAGGTGGCGTAGAGCAGAGCTTGTGTTGGTTAGGGA
ACGAAATCAGGGAGACAAGGGAGGAAACACTCATGGCTAGAAACTGGCGTTGTGTGTGAGGTTGAGAGAGCATTACTGAG
CGCTGCCTAGAAACCTCAGGTGACCTTGAGGAAGAAACCATGTGAGTCAGGGCAGGGTCATGACTTGGATGGGTTGAGAT
AATTGTTTCTCTGAGAATTCTTTCACCTCATATATGTTTGTACCTTGATTTGGGCTTCTCAGAAGCCCCCAATCAGTAGC
AGAAGCCTGTGGAAATCCTGTAATAATTCTGGAACGAATATGAGATACACTTCTCAGTTTTTATGGTACGGTTGACTGGC
AGTCAGCAACAGTAAGTAGAGGGAAAATTACACTGATAGATCC
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857407..97857848 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST10075H2BBF1
Sequence
CACAGGCCCTAAGTCCTAGATGCCCTAGACGTACCCAAACACTCACCTTCCTCTGAGAGCCAAGAAGTTGAGTGTGCCAA
TAATGAAATAACTGAAAAGCTACTACTACCCAAAACTACGTGGTCCTCGGCAGTGCTCAGCAAGCCCTTTCTAGTCCCTG
TAAAAGATTTGCTTACAGTTGGGTAAGGCCCACCTCTGAGTTTGTAGGTGGATGGTTAAGGGTTTATTTTTAAAGATTTA
TTTATTTCATTTATGAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAGACCCCATTACAGATGGTTGTG
AGCCACCATGTGGTTGCTGGGATTTGAACTCATGACCTCTGGAAGAGCAGTCAGTGCCCTTAACTGCTGAGCGATGCATC
TCTCCAGCCTGATGGTTAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97856986..97857409 424
 
EST/CDNA Est Name
  CX733968.1

 
Come back to gene CX733968.1


For any suggestions or comments, please send an email to unitrap@crg.es