Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P075A12
Clone ID P075A12
Vector FlipROSACeoC-2
Project ggtc

Sequence tag P075A12
Sequence
TCAGCGTCCAGGCCTTGGCAAGGCTTGGGCGACACTGCCGGGTTCCTGCTTGCGAGCGGTCAGCANNNATCTTCTCCTCC
TCTTTATATTGGCGCTAGGTGGGGGGCGCAGCGTCCAGGCCTTGGCAAGGCTTGGGCGACACTGCCGGGTTCCTGCTTGC
GAGCGGTCAGCATGCATCTTCACCTGCTCTTGATATTGGCGGTATTTCGGGCCCGCTGCGTGGTGGCAGGTCCTAGCTAC
AGCCTGAGCGGGAGCTGGCGGGTGAGCAGCGGGAATGGCTCCCTGGAGCTACCGGCGACTGTCCCCGGCTATGTGCACAG
CGCCCTGCACCAGCACGGGCTGATCCAG
Sequence Type mRNA
Unitrap ID UNI7878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135148566..135148821 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es