Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15082H3
Clone ID IST15082H3
Vector VICTR80
Project tigm

Sequence tag IST15082H3BBF1
Sequence
CCATCTTCCTTGTGGCTCTCTGACAGTTCTCTGGCCATTCGATAAAGTCATCCAGAATTTACCCCTTCTTGCTAGTCTAG
TAGGAACTCTGACCTGCTCTGGAGCACAGCCTTTTGACAGGGGTGCAGTGTGGATGTCTCTCACTGTGGACATGAGTTTT
CCATCTTCTCAGGATCTCTTTGGATTAACAGAAGCAAGCTCTGCTGCTGTGGCTCTCTTTAGAGTTAGTTTTTCCTGGGG
CTTAAACATTTGCTAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119491270..119491531 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]


Sequence tag IST15082H3HMF1
Sequence
CCATCTTCCTTGTGGCTCTCTGACAGTTCTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119491270..119491303 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es